Strange Lines and Distances


‎"We have also sound houses, where we practice and demonstrate all sounds and their generation...Divers instruments of music likewise to you unknown...likewise divers trembling and warblings of sounds, which in their original are entire...We have also divers strange and artificial echoes, reflecting the voice...We have ...also means to convey sounds in tubes and pipes, in strange lines and distances..."


Francis Bacon's 'Bensalemians', dwellers of Atlantis, describing their music in New Atlantis (1626).

Fragment

A publisher is interested in a longer piece, from which this is extracted. Some work to do but I like it, or at least the atmosphere it reminds me of.



Every Storm Ends


(c) Cameron M. Smith


I watched as Chiu cleared snow from the rock wall, found a crack, and began hammering in a piton. Blowing snow sped through my headlamp beam. I couldn’t see Chiu’s face. I looked up towards where the summit should be but there was only a black triangle of starless space. I looked over my shoulder and down, but there was nothing there, either, just snowflakes flashing past. We might as well be on a ledge in space.




I listened to the pitons as Chiu hammered them in. The first sounded good, the pitch rising with every blow of his ice hammer. The second went in poorly with clacking sounds and the third, in crumbly rock a couple of feet away, crushed rock and then wobbled when Chiu tested it before striking again, ineffectually.




Chiu worked stiffly and I watched stiffly, all my muscles tensed, clenched together, pulling myself in on myself as the temperature dropped. We’d spent the day wallowing up big gullies full of loose snow and were soaked with sweat before we set foot onto the summit slope. When we did, the sun was just going down and we looked up five hundred feet, and down two thousand feet, and all but simultaneously said “Let’s get out of here, we’ll freeze to death.”




But going down the gullies—and over a couple of steep sections we’d ascended—would mean traveling right where the avalanches would come as the snow accumulated. So we made our way to a ridge that we knew to drop down through darkness to the valley floor below. We picked our way down the rocky spine carefully, each step down explored ice axe thrust to be sure we wouldn’t trip. The rock composing the heart of Dead Man Peak was crumbly and shapeless, and we rarely were able to hammer in a piton to clip our rope through as we climbed down. When we rested once we said a few words about untying the rope and making our way down alone, but we were tired and cold and it seemed too much trouble. It was a conversation we’d had a dozen times. “Just don’t fall,” one of us said, the other nodded as we wiped snow from our goggles and continued down.




After a while the ridge became steeper, requiring us to turn and face the rock and clamber down using all four limbs. Finally I stopped where it was too close to vertical. I hooked my ice axe on the rock and leaned out and back, looking down. My headlamp showed the rock wall steepening below and then blackness. When Chiu arrived I said “Be careful. Don’t fall.” He nodded, kicked his boots to settle in, then looked down, then up where we’d just been, then left and right, where the gullies, unseen in the dark, flanked the ridge. There was no other way than to begin rappelling down from here.




Holding tight to my ice axe, I started to carefully kick snow off the little ledge, so we could see what we were standing on. Chiu dug in his pack for his water bottle, but there were only ice chips rattling around in it. I knew mine was empty. Chiu put his pack back on and started hammering in pitons, clipping himself into the first one so he could’t fall off the ledge. He clipped me in as well as I worked with the rope.




When the pitons were in, Chiu turned off his headlamp to conserve the battery. As he clipped a network of webbing to the pitons I arranged the rope for a clean toss. “Want to go first?” I asked, but I knew the answer. It was another conversation we’d had a dozen times. “No,” Chiu said, “you’re heavier.” If my weight ripped out the anchors, at least Chiu could try to climb out alone. I clipped the rope through the carabiner connected to the pitons, tied the ends of the rope together so I couldn’t slide off the end by accident and fed a bight of rope through the rappel device that was clipped to my waist harness. My stomach rolled over. Chiu grabbed the a loop on my backpack as I pulled down hard on the anchor sling. Nothing, the pitons didn’t move. I felt sick but leaned carefully back away from the wall. No movement. Chiu still had a firm grip on my pack. I nodded and grunted “OK.” Chiu let go of my pack and then swiftly unclipped himself from the anchors. If they blew out I’d take them and the rope with me, but I didn't have to take Chiu as well.




I began lowering myself into the darkness."




Dive

Photo looks up at the bouy rope as Todd and I descend to the sea floor.

Arctic Sea Sailing

Wonderful video clip.

No Alaska

The terrain I identified for flying over a year ago has changed hands; it's no longer Bureau of Land Management land, but private property that is apparently unavailable for me to fly from. Getting permits for the nearest flyable terrain will take months; it'd be Spring before I got them. So I'll start on that permitting process now and fly next winter. Urgh. Well; it will only make the flight, when it finally happens, that much richer.

After grading, straight into the water to dive, dive, dive!

Finally - an Emotional Heart for Space Exploration

One step forward! Opera for space. This is one small moment in the whole opera -- which I have now on DVD -- but all time is composed of individual moments.

What a Beautiful Season

Gear Packing Overview

Looking over what needs to be packed (click for video clip).

Tent Check

Hopping in the tent to check zippers and patch holes, my heart begins to hammer as I think of the cold and the wind. I'll lay there in the tent and unzip the door to look at the wind; can I fly today? I'll roll around in my sleeping bag, too hot sometimes, or freezing, always wondering about the wind.

Helmet

Just wrapped up attaching lights and laser to my flying helmet for this coming Alaska flight expedition. An unedited (no music etc) clip below:

An Infinity of Galaxies

"To be able to rise from Earth; to be able, from a station in outer space, to see the relationship of the planet Earth to other planets; to be able to contemplate the gift of life unencumbered by proximity; to be able to meditate on journeying through an infinity of galaxies; to be able to dwell on the encounter of the human brain and spirit with the universe--all this enlarges the human horizon. It also offers proof that technology is subordinate to human imagination. We went to Mars not because of our technology, but because of our imagination."

Norman Cousins, 1976.

2+PSI Blowout

Some weeks ago I entirely removed the pressure suit’s first, totally inadequate helmet-suit interface collar, and cleaned all the surfaces with acetone; a week later I glued on a much-improved interface collar, spending a precious eight hours minutely adjusting and gluing the interface as closely as I could, dealing with each wrinkle with millimetric attention and clamping several areas as the glue dried. After this interface glue had cured for a week I made another minute inspection of the interface and applied a number of patches where I suspected problems might arise. I let those patches dry for another week, some of them under clamp-pressure.

Today (Sunday 14 Nov), about a year after the first pressure test, I sealed off all the suit’s through-holes—breathing gas intake, breathing gas exhaust port, and pressurization gas intake—and pressurized the suit. I was thrilled to watch the wrist-mounted pressure gauge rise minutely from 0psi to .5psi to 1psi and then, unbelievably almost, considering all of the potential problems, to 1.5psi. At that pressure, with the suit inflated like a grotesque mannequin, I pressed on the chest—no leaks. To heck with it: like making another move upwards on a difficult climb, even though it might feel imprudent, I sat fully on the suit’s chest, folding up my legs like a guru and applying my entire 180lb weight to the suit; surely this would expose any weaknesses…No leaks! The suit remained pressurized. Fantastic! I stood the suit up—it’s remarkably lightweight—and it remained so rigid that it would even stand entirely by itself, though I’m not sure how that’s possible as the suit’s feet are slightly rounded at the sole! I’ve been dreading pressure-testing the most recent interface collar for some time, telling myself I should let the glue dry another day or two—but this couldn’t have been going any better!

I laid the suit down, thinking that I might do well to give it a name before long. After all, I live with this thing, laying over there on the table, daily, always in view even under its dust-cover sheet, never more than about 20 or 30 feet from me as I cycle through my daily life of cooking or writing or reading, reminding me of the project every day and every night and every morning.

More pressure; was it possible? I kept pumping. The wrist gauge climbed to a hair over 2psi! I was 2/3rds of the way there!

Humans have evolved under about 15 pounds of pressure per square inch (psi) of atmosphere pressing on every square inch of our bodies for the past four million years; we live, one diver has remarked, under an ocean of air, it presses down upon us just as water pressure presses down on a diver who goes further and further down under water. Climb a mountain or go up in an open-cockpit plane or balloon, and less and less atmosphere presses on your body, leading to a number of symptoms; mountaineers call it altitude sickness, and it can result, at altitudes over 20,000 feet, in death as the body swells up like a balloon as less pressure holds the body together. Pop out of a spacecraft into space, where there is zero atmospheric pressure, and the body’s tissues and fluids will in a few seconds simply fly apart, with none of the pressure it’s evolved under holding the tissues and fluids together. Thus, in the last 60 years, the invention of pressure capsules and pressure suits that contain a bubble of pressure about the body, keeping the tissues and fluids all together. A spacecraft, then, is just an elaborate can that is filled with enough gas pressure to prevent the body from flying apart.

You don’t need 15lb of pressure holding you together to survive, however: at the summit of Mt. Everest, at 29,002 ft (8,840 meters), there are only about 5 lb of pressure, and this has been endured by climbers, again and again, who use a variety of techniques to adjust their bodies to high altitudes and the attendant lower atmospheric pressures.

But at 50,000 feet—my target altitude—there are only about 1.7 lb pressing on each square inch; by no estimation so far is this enough to survive. One survivor of an accident in a low-pressure chamber recounts that, just before blacking out, he could feel the water in his tongue begin to boil.

But you can, wearing a garment that can be pressurized (a pressure suit), survive at about 3 psi if (for a number of reasons) you’re breathing pure oxygen. Fair enough; aviator’s breathing oxygen is easily commercially available, and it’s delivered from tanks and regulators in principle identical to SCBUA breathing-gas tanks and regulators, though aviation systems are built for high altitude rather than underwater. I’ve acquired and built these hardware items into the suit. That has been relatively straightforward.

So; my pressure suit needs to hold about 3psi to be workable for my project. I’ve consistently found that the hardware (other than the breathing gas intake and exhale valves on the oral-nasal mask) is not the problem; the problem is maintaining pressure in the pressure garment. And this problem holds not at the gloves or the various gas intake- or out-ports, but at the helmet-suit interface collar. That interface is the chief goblin of this whole project so far.

At somewhere just over 2psi the suit was still holding well. Unbelievable! I’m 2/3rds of the way to a survivable pressure! I pumped a few more times, then; HSSS and the suit deflated, collapsing down rather sickeningly. The suit was face-down at this point, for a number of boring technical reasons, and as pressurization gas leaked from a sudden breach in the interface collar, the suit took on a pretty depressing aspect. Ugh. Watching it deflate brought the reality home: if that happens at altitude, I’ll have little time at all—if any—to crash dive my airship or simply bail out to get down to survivable pressures (say, 20,000 feet, where pressure is normally around 7 psi) before rapid decompression kills me. Damn!

I disconnected the pressurization hose, laid the suit face-up on the table and, as though conducting an autopsy, opened the helmet to examine the interface collar from inside the suit to find the breach. It was immediately apparent; the glue had simply given way at one conspicuous point inside the suit.

So: it’s either re-glue, or take the system apart and rethink and rebuild the entire helmet-pressure garment interface collar. At this moment I think I’ll do the latter. That will take months. Lots of sketching and brainstorming to do; but of course that’s part of the exercise, simply learning how to build my own pressure suit.

The other week I discovered that you can simply buy a pressure suit from the SOKOL company in Russia for about $20,000; and don’t let that low figure (about 1/50th of the cost of a US-built pressure suit) fool you into thinking the SOKOL pressure suit is sub-par. SOKOL suits are in fact, due to a simpler and more robust design, better in my estimation than NASA pressure suits, and they have been delivering and returning cosmonauts to space for over 40 years with not a single lethal failure. The SOKOL pressure suit’s main pressure seal is a simplicity-of-design masterpiece that lightens my soul—the fact that it exists allows me to breathe. I’ll describe it sometime, but for the moment, I can just say that there are human inventions that achieve a great deal but, mind-bogglingly, achieve this not by virtue of their complexity but by virtue of their simplicity. This morning I read an article about Russian gulags of the 1930’s; it reminded me of things I’d read years ago in Babi Yar, an account of a Ukranian boy who survived the German invasion of Kiev during World War II. I’m not sure how to describe it, yet, but I’m convinced there is a connection between the brutal simplicity of Russian gulag thought, Russian materiality and and the SOKOL space-suit’s almost laughable—and entirely adequate—simplicity.

The whole idea that space—which gives us access to nothing less than the whole universe—is cut off from the common person because ‘only NASA can do that’, the whole elaborate and Hollywood-engrained world of ‘The Right Stuff’ is, in my opinion, a sham. Everyone can get into space. The universe does not belong to the military-industrial complex, it belongs to everyone. And building the tools to get there isn’t necessarily a soul-less, flag-waving, militaristic, mechanistic endeavor; it can be done by everyday people, at home, while they listen to Garrison Kiellor describing the sweetness of a different kind of life entirely as they tinker with a valve or a hose-clamp.

Like Russian SOKOL pressure suits, US Navy Mark V suits—entirely adequate for my plans—appear on ebay every once in a while, going for about $10,000, and I have good reasons to believe they’d probably still hold life-supporting pressure. I guess I could come up with that money, but my point is precisely to show that I don’t need to do that: I can do it by myself: such a project isn’t the domain only of the US’s military-industrial complex or the Russian space program, but attainable by me in my apartment on a very modest budget (I have all my receipts, a good many of them from Ace Hardware, but I haven’t bothered to sum them up yet) on Sunday afternoons, while listening to the radio. I don’t want sponsors for this expedition; I don’t want help from the world’s best engineers, who could certainly solve all my problems in a matter of minutes. I want to do it myself.

Learning by trial and error here in the ‘workshop’ is exactly what I’m supposed to be doing. It’s energizing, in an interesting way, to encounter this problem necessitating a rethink of the whole helmet-suit interface design. I’ve found that every time a system has failed, the redesign has been both simpler and better than the first design. This is particularly so with the enormously-problematic oral-nasal mask, which I finally have perfected (after nine rebuilds) by building in two special valves and then, importantly, completely reconsidering and rebuilding the intake and outflow hose routing with an enormously-improved system that ‘came to me’ (a phrase that’s worth serious contemplation) one morning when I was waiting for the tram to work, ‘just’ sitting there on a bench, ‘just’ thinking.

Below, aviation pioneer Wiley Post in his mid-1930's pressure suit, which sustained him to an altitude of 49,000 feet:



So far it’s been about nine months from concept drawings to having the assembled suit ready for that first test; after that it was about a year from that test until today’s test; will it be another year before I achieve and hold the suitable pressure? Maybe, although the problem this time is very limited to just one new interface design. I’m getting there.

Anyway—many months more, then, of brainstorming and endlessly fascinating reading about the principles of bioastronautics and the history of pressure suit design.

Before that can even begin, though, I have to force myself to put this project away and prepare for Alaska. Tonight; restock my medical and repair kits, sew a riser sheath for more easily stowing my paraglider risers while wearing mittens, and, if I can get to it, work on the helmet laser mount.

Sea Floor Life, Hood Canal

In addition to a new 'garden' of 'sea whips' standing as tall as I am at 130', on a recent dive Todd and I saw this amber-colored life form at about 90'. I haven't had the chance to look it up.

The seafloor lifescape changes over the years. There are distinctively different life regimes at 10', 30', 90', 100' and so on. And over the years they have changed as oxygen levels in the waters change for complex and incompletely-known reasons. We haven't seen a sea slug for at least a year, for instance, whereas they used to be the most common life form at about 40'. And whereas the garden of sea whips used to reside around 100', now there is a new one between 130' and 140'. If I could dive more regularly, I'd like to begin a systematic survey, but that simply isn't realistic.

Below, the best photo we have so far of a 'sea whip'. This is the life form that stood in a colony at 130'-140' last time, some as tall as I am.

Fantasy

From "Wanderer" by Sterling Hayden. The writing, once you're in it, is engrossing. Here the author describes a teenage fantasy--while living on a forested New England island with his mother one winter--of going to sea; which he eventually did, sailing ships around the world several times in the 1930's.


"I closed the book and gazed at the moon all mellow and amber as it came rising out of the sea, and it seemed I couldn't wait until my life at sea began. I bundled up and said to my mother: "I'm going on watch."

I stepped into the night. The island became a tall ship on a moonlit sea with her granite stem tossing the groundswell aside and the wind in her pinebough sails. I studied the path of the moon, then moved to my place of command on the little dock shaped like a quarter-deck. There was a crust of snow on the handrails and ice on the planks and the wind blew hard from the north northwest."

"Oh how it blew! And oh how she sailed that night! I locked my hands behind my back as I paced by the hour with never a word to the helmsman. The lights one by one slid from sight behind the hill of the world till we were all alone in the path of the moon--locked in the bone-gray arms of an ever-increasing breeze. From time to time I'd stand in the lee of a tall spruce mast and nibble my fruit or crackers; and aloft I'd see the drift of the clouds with the branches in silhouette and the star-studded sky looking down. And it came to me that this was surely the most beautiful sight in the world---the pines, the clouds, the stars, and the sky, on a windy night in the full of the moon and alone on the coast of Maine. You could hear the bells in the course of the hours, and the men took their turn at the wheel. The moon went from amber to ivory--and the pine sails raged in the wake of the wind, and I thought of holding the deck till dawn--"


Night Swim Out

Diving over the weekend; last time for a while I suspect, with Alaska coming up. Five dives, all memorable; but for the moment just a sketch of swimming out at night. We swim out on our backs, with out bouyancy vests supporting us. In my left hand is a hose and control to inflate or deflate the vest, and in my right is my breathing mouthpiece (regulator) ready to put in the mouth when we dive or if my vest unexpectedly deflates. You see one of my fin tips on the right, but in practice my fins never break the surface on the swim out. It's night, and my wrist light shines up into the rain coming down and splashing on the black water. The sketch is primitive, flat and noncommital; it's not near final, just getting a feel for this picture.

Pressure Suit; Significant Progress to Wrap Up the Year

Time to shift gears to Alaska preparations. Unable to bring myself to actually type another single character (on the next book project) over the weekend I decided instead to get the suit--now Mark II--up to pressurizable condition before wrapping it for storage until next year (although it might just be possible to carry out one pressure test before Alaska). Photos below.



Having completely dismantled the neck ring attachment some weeks ago, this weekend I cleaned all surfaces and re-glued the interface with a wider glue brush (big improvement), redundant coverage of the interface rubber, and clamping the glued surfaces together when needed to improve the bond. I think this will work to prevent even the smallest leak. Testing will reveal whether it's worked or not.



Months of careful decision-making led the the final moment; starting to cut through-holes for installing ducting through the pressure garment.



Installing through-hole hardware. In this proof-of-concept suit, I'm using nylon hardware, but this will be changed out for metal, which shouldn't crack at -60F, which nylon might do.



Looking over the suit with through-hole hardware attached; hoses for pressurizing the suit, admitting breathing gas, and dumping breathing gas are all present; electrical / communications and liquid coolant hose in/out ports remain to be added, though the suit can be pressure-tested without these.



Closeup of some of the hoses etc. There is a lot of clutter, obviously, and Jack Shimko, who came to look at the suit, said 'This looks crazy. You have to take care of this before you reveal it publically, or people are going to dismiss you as a madman.' I agree, and in fact months ago I established--with the production house building the coverall that will protect the pressure garment you see here--that the coverall will considerably clarify this clutter (important from a flight safety perspective) and will 'look' to some degree what people expect from a 'space suit'. Building that coverall all hinges on successful pressure tests, so it will be a while yet before that happens.

Interstellar Propulsion

Fantastic!

Abstract

"Realistically, it is difficult to achieve [interstellar propulsion] using current space propulsion science and develop the prerequisite technologies, which for the most part requires the use of massive amounts of propellant to be expelled from the system. Therefore, creative approaches are needed to reduce or eliminate the need for a propellant. Many researchers have identified several unusual approaches that represent immature theories based upon highly advanced concepts. These theories and concepts could lead to creating the enabling technologies and forward thinking necessary to eventually result in developing new directions in space propulsion science. In this paper, some of these theoretical and technological concepts are examined – approaches based upon Einstein’s General Theory of Relativity, spacetime curvature, superconductivity, and newer ideas where questions are raised regarding conservation theorems and if some of the governing laws of physics, as we know them, could be violated or are even valid. These conceptual ideas vary from traversable wormholes, Krasnikov tubes and Alcubierre’s warpdrive to Electromagnetic (EM) field propulsion with possible hybrid systems that incorporate our current limited understanding of zero point fields and quantum mechanics."

from
Robertson, G.A., P.A. Murad and E. Davis. 2008. New Frontiers in Space Propulsion Sciences. Energy Conversion and Management49(3):436-452.

Fitting sounds below, to me conveying distance.

Bailout Issues: Thinking Aloud

The main safety issue I face in flying my wing in Alaska this winter is a catastrophic collapse of the wing. This is when the leading edge of the wing curls down and forward (for a number of reasons), blocking the intake vens that keep the wing inflated and thus in an aerodynamic shape that provides lift. Many wings, incluing mine, are designed to automatically recover from a collapse with slight or no pilot input into the controls; this assumes that one has sufficient altitude to make the recovery maneuvers or just let the wing recover on its own. Low-altitude collapses of this kind are very dangerous because you face hitting the ground before the wing recovers, but they can be avoided in part by thinking through the flight plan very carefully and avoiding obstacles that create turbulence and avoiding low-altitude turns, which is not always avoidable if you're landing in a constrained space. I address these issues below.

Many collapses occur in thermic conditions, when the air is turbulent; this can happen anywhere; at liftoff, in the air, or during the final landing phase. Launch collapses can be avoided by not launching in anything but perfect conditions, and in Alaska I will not launch except in perfect conditions which will be: (a) a steady (in speed and direction) 4-8mph wind coming right up the slope at me (I trust my ability to sense the wind speed and direction, but I'll be aided by setting up a wind sock at the launch site and by carrying a hand-held anenometer, which measures wind speed) and (b) good footing (e.g. firm rather than deep snow).

In the flight cruise phase, which I'll begin seconds after launch on mountaintops between 922 feet and 1,350 feet above the ground, I should not have collapse issues because I will not be flying in thermic conditions. In the event of a high collapse that doesn't 'self-recover', however, there are two options; in some cases one or two control inputs by the pilot can reinflate the wing, but if this fails the pilot can throw the bailout parachute. My bailout parachute is mounted on the lower back of my flying harness, and I'll come to that below.

In the landing phase I face potential collapses if the wind changes between launch and landing; to set up my landing the terrain I've identified for flying demands that I make a normal DBF approach, or Downwind, Base (crosswind) and then Final approach to the landing site. Doing this requires two 90 degree turns, one for the Base (crosswind) and one to set up the Final approach; in practice this might well be one long slow 'U-turn' to the right (one of my first DBF setups is here). I have made many of these approaches and I feel fine setting up such an approach where I will fly, based on my knowledge of how my wing performs and very close examination of maps of the terrain. I will be able to identify the landing site wind speed and direction because before flight I will have set up a luminous (glowing) windsock at the landing site to help inform my landing maneuvers. There are a few hours of light daily, even though it's Arctic Winter, and that should be enough to 'charge' the wind sock; if not I will also fit it with a small LED light which, I know from experience, can last hours, plenty of time for me to turn it on and then hike the mile or so (and about 1,000 feet up or so) to the launch site, launch, and land.

I'll begin setting up my landing phase maneuvers around 500 feet above ground, which is closing in on the bare minimum for throwing the bailout parachute and having enough time for it to open properly and support an emergency descent and landing. Landing under the bailout parachute is not as smooth as with the wing, so in the last moments before touchdown the pilot must prepare for a PLF or 'Parachute Landing Fall', which I've practiced, but need to practice more at the park by jumping off a step-ladder and landing with a rolling, flexed-body posture that disperses the energy of landing. I also will wear ankle-protecting braces that have been shown by military paratroopers to drastically reduce ankle injures during PLF's; I have to integrate these to my boots, which is a whole separate topic (my boots also have to be attached to my flying suit--itself a design issue--because I know from experience that a good way to lose one of these boots is to run in deep snow in them, as in a takeoff run).

In darkness, depending on the starlight and moonlight, the snowy terrain below might or might not be easy to spot, so I will fly with a powerful laser attached to my helmet; I'll switch the laser on on just after launch. This laser is powerful enough to burst a toy balloon, but is only the size of a roll of quarters; within 500 feet of the ground it puts a bright green spot on the snow which considerably helps to identify where the surface is, how quickly you're moving, and whether the terrain is rough or smooth; though I only made a few 2-3-second 'hops' two Winters ago (this Winter's flights, based on my calculations, should last around 300 seconds or 5 minutes) I found the laser to be enormously helpful in orienting myself, so mounting it and getting cold-resistant batteries for it, and making a clamp that keeps it on continuously (and that I can operate with gloves or mittens on--more about this below) because it presently has only a button that has to be held down to keep the beam on, is another task.

Although a collapse during any phase this Winter is exceedingly unlikely because of the strict rules I'll impose on myself for launch and flight, I do need to prepare for it by making the bailout parachute easy to deploy in a way that guarantees that it will open up properly above me.

To do this I've unpacked the bailout parachute from harness to the main parachute bundle (photo below). Here you can see the parachute risers leading from my harness to the bailout parachute. Minute inspection of the lines revealed no weak spots, but one possible tangle-inducing kink.





I removed the kink from the risers nearer the parachute bundle, and packed the lines carefully in their quick-deploying rubber band constraints (photo below).




After this I packed the parachute bundle in its pouch in the lower back of the harness (photo below) and closed the flaps in the correct sequence, finally inserting the release pin (more photos below).









With the bailout parachute carefully packed for a 'clean' deployment, I put on the harness and reached back on the right for the handle, as I would during flight; pulling the handle rather forcefully (needs quite a yank, actually) removes the release pin and in one long yank the parachute bundle flies out to the side, followed (in a clean deployment) by the risers being torn from their rubber bands by air resistance and, soon thereafter, the opening of the bailout parachute.

Without gloves, finding the release handle is easy enough (photo below). But I cannot fly in -20F or -40F without gloves.



The mitts I prefer to use are so clumsy for this task (photo below) that finding the release harness is not easy; and, remember, I may only have seconds to do it in the moments after an unrecoverable collapse. Though mitts are always warmer than gloves, the loss of dexterity simply isn't acceptable.



Wearing medium-thickness gloves rather than mitts (photos below) make it easier to feel and find the release handle, but, still, neither of these gloves are acceptable; they're still just too clumsy to find the handle quickly and flawlessly; and the bailout throw has to be quick and flawless.






Wearing very thin gloves seems to be the solution, but they're not warm enough; I know that much from many bitter, bitter experiences. One side of one finger in fact is permanently numb since a trip to Iceland in 2001. And one of my closest shaves was during my first trip to Alaska, where my hands froze on a completely calm, perfect -30F day (I was testing a clothing system that, obviously, didn't work), preventing me from even zipping up my parka (my fingers wouldn't clamp around the zipper pull) which led to my torso freezing and my coming very close to hypothermia as I battled for three hours to set up my tent, light the stove with matches clamped in my teeth, and just barely avoiding becoming a human popsickle. So I take very good care of my hands, now.

If I need thin gloves to feel the bailout handle, but normal thin gloves are too 'cold' to work with (at -30F it only take about a minute to freeze my hands without good gloves or mitts), one option is battery-powered gloves (pictures below); these have wires threaded through the fingers which the batteries warm. But these are a poor solution; batteries fail, wire leads break, and, finally, these gloves aren't windproof, and wind cuts right through them. No good, either.



Solution? I don't know, yet. Lighter, windproof gloves _over_ the battery-warmer gloves might work (photos below) but I hate to rely on batteries, again, and even so this still makes for pretty crummy dexterity and the chance that I won't be able to find the bailout handle in time. So this is the dilemma; what hand-insulating system do I devise that keeps my hands from freezing but also makes finding the bailout handle possible, nay, guaranteed and instant?





These are the kinds of details wake me up at 3am. I envision a collapse and a fumbling for the handle as I plummet down towards the sea ice. These are the kind of details that make for the difference between life and death, and they're precisely the kind of details that accident investigators piece together to find the ultimate reason for the disaster: "He had plenty of altitude and a good bailout chute, but he couldn't get at the handle because his gloves were too clumsy."

I'm confident I can solve the problem (I won't fly without a solution), but finding it will take time and experiments.

New Gas Routing System

After the ninth rebuild of the oral-nasal mask, which finally sealed up all leaks and installed the inhale / exhale valves from a military MBU 20/P flight oxygen mask (photo above), I thought I had the system settled; photos of this happy moment, below.



But, as often, I was dead wrong. Fitting the inhale / exhale hoses to the Russian-made inhale / exhale ports has frustrated me for months, and as well as this new configuration seemed to work in principle, turning on the gas to breathe in and out revealed new problems with my system. The mask and its hoses are fine, but once again the ducting to the helmet ports was inadequate and would leak at high altitudes.

Staring at the pile of hoses and ducting I came to the solution at long last; why was I trying to fit the mask hoses to the helmet ports? Because, of course, on the helmet, that is were the breathing gas comes in and goes out. But I don't have to be constrained by that! Because my suit, below the neck ring, will be different from the system work with this helmet, I am going to completely seal up the helmet intake / exhaust ports and route the gas management hoses through chest vents, precisely the way I want. Streetcar-ride sketch, in the way to PSU this morning, below, shows the new arrangement. This is going to work!



The lesson: always be ready to rethink from first principles, and don't be mentally bound by existing systems.

Trees

The season is changing again. It's completely silent except for the rain outside; not a car or person has gone by for at least an hour. I'm re-rigging my reserve parachute for flying in Alaska this winter.







Photos; 'just' some trees on the Ridgefield Wildlife Refuge, on a recent beautifully wet and windy day. After five years the plankhouse is taking on character, now, warping with water and gravity and colonized by all manner of small life.

And a poem by Lynn Martin for the season;

Under the Walnut Tree

When I face what has left my life,
I bow. I walk outside into the cold,
rain nesting in my hair.
All the houses near me
have their lights on. Somewhere,
there is a deep listening.
I stand in the dark for a long time
under the walnut tree, unable
to tell anyone, not even the night,
what I know. I feel the darkness
rush towards me, and I open my arms.

–– Lynn Martin

Book Cover

Last tasks now in formatting references and some art -- and Prometheus has sent me the cover. I'm thrilled!

Other Seas

“The mind, that Ocean where each kind,
Does straight its own resemblance find,
Yet it creates, transcending these,
Far other Worlds, and other Seas.”


From The Garden by Andrew Marvell (1621-1678)

Books I Want to Write

This morning, for the first time in a long while, I didn't read evolutionary biology at the cafe. That book is winding down, though the next 72 hours are going to be extraordinarily intense.

This morning I thought about books I wish I could write.


* Interstellar Navigation at Near-Light Speeds: A Primer.

* Encyclopedia of Saturnian Mid-Atmospheric Life Vol II: Aerial Fruiting Bodies.

* Five Years on Europa.

* Excavations at Dreikarta: The Rise and Fall of a West Martian City-State.

* The Arts in Trans-Generational Starship Cultures.

* Practical Asteriod Homesteading.

* First on Pluto.


Explorers

Some day, some lucky person will listen to this as they watch the Earth diminishing in the distance.

Goodbye, Earth. Thank you.
Now...what is out here in this universe?

Ibex and Fox

Just for sheer enjoyment, beautiful woodcuts of ibex and fox from Edward Topsell's 1607 "Historie of Foure-footed Beastes, Describing the True and Lively Figure of Every Beast."

Images are archived at the University of Houston Online Special Collections Library.

Evolution book is looking to wrap up at about 250 pages, exactly as specified on the contract. What an adventure it's been! One week to go I think.

Another Figure

New figure for gestural communication in dogs, elephants, and humans. I've wanted to use these images for years. Caption in progress; submissive dog shows antithesis to every element of the aggressive dog posture; male African elephants flap ears (top) and touch trunk to forehead in warning; detail from an 18th-Century French guide to painting showing postural language of different social classes, including 'proper' way to hold items (lower left). As usual, printed here in white on black, which is what I prefer.

Some monstrously complex issues to wrestle through tonight but I have two years of notes--actually, twenty--guiding me.

Progress

Just cracked 100 pages on the evolution book; another eight hours down in this basement and things are falling into place. A new figure regarding levels of biological organization, above. Tomorrow, more of the same.

'Anonymous Blobs'

Image and caption for "Chapter 3: The Fact of Variation" of the evolution book.

Text:

For example, in the top section of Figure 3-2 we see a schoolbook diagram of the lifecycle of the moon jellyfish (Aurelia aurita). At (A) you see the adult form of the jellyfish, which has released a proto-offspring, the planula larva (B) after about a week of growth. The planula settles onto a rock (C), where it develops into the scyphistoma (D and E) with tentacles allowing it to feed on passing nutrients. Eventually the scyphistoma develop into the strobila, a sort of stack of immature jellyfish on a stalk (F) that can bud off offspring (ephyra) for several years. When one of the ephyra are released (G), if all goes well, they develop into the immature medusa (H) which grows to adulthood (A). Note that this schematic drawing shows a single, largely-symmetrical ephyra (G). Seeing such a depiction in a textbook, we internalize a fixed image in our mind: this is how Aurelia ephyra look. But look at the lower part of the diagram, which shows the actual appearance of twelve Aurelia ephyra captured off the coast of California in 1996. Note that no two are identical; for reasons we'll examine in this chapter, there is always variation--even in this world of ‘anonymous blobs’.

Text and image (c) Cameron McPherson Smith 2010.

All Thanks to Ted Edwards

My story of thorablott, the Icelander's Winter Feast, is now available in The Best Travel Writing 2010. The publisher, Solas House, will be publishing the whole book from which this is an excerpt in 2011 or 2012, under the title "The Frost Giants".

It all began with a book, Ted Edwards' 'Fight the Wild Island', a tale of his trek across Iceland in 1985, which I read in Canada in 1996. If a proximate cause for my getting drenched, frozen, thawed, wind-whipped, tumbled, humbled and addled in Iceland's wild wastes winter after winter, it is having read that book. Although my manuscript of "The Frost Giants" is in rough shape, and I can't even start on reworking it until next year, I'll be sending it to Mr. Edwards for his amusement before long.

Fireflies and DNA Transcription

Two new figures for chapter 2: a schematic of how DNA keeps cranking out near-perfect cells, moment by moment, and the complexities of mate-recognition in the world of a female firefly. Captions below. These images are inverted because I prefer them that way; in the book, the DNA image will be black-on-white. About 29 days to go, now.

CAPTION for Figure 2-1: Multicellular life forms (metazoa), such as a human (A) are composed of a wide variety of cells (B). Each cell contains a nucleus (dark spots in B) which contains chromosomes (C), the ‘nuclear threads’ observed under the microscope even in the 1800’s. Each chromosome (D) is actually a long ‘thread’ of the DNA molecule, tightly wound like a telephone cord (E). The twisting-ladder-shape of the DNA is composed of the phosphate rails (white and black ‘strips’ in E) that connect the rungs (F) of adenine, cytosine, thymine and guanine (A,T,G and C, becoming visible just to the left of label (G)). Although there isn’t room to show a whole gene in this figure, animal genes are normally around 1,200 ‘base-pairs’ long, schematically shown as a set of base pairs from (F1) to (F2). Base pairs are arranged in triplets (codons) such as (G), the codon TAC, which specifies the production of Tyrosine. When DNA is used to make a protein (e.g. to build cells to replace dead cells) an enzyme called helicase (the long gray oval, (H)) runs down the length of the DNA (moving to left in this image), ‘unzipping’ the DNA double helix, separating the base pairs. The helicase copies the base pair codons of one side of the DNA ladder (lower and middle rows) and streams them off in a tail-like chain. That chain (I) eventually moves out of the cell nucleus, merging with a ribosome (J) which attaches free-floating chemicals (A,T,G and C) that will only bind to the appropriate codons, together in the appropriate sequence (K). The resulting amino acids (in this case, lysine, aspargine and glutamine, assembled in (L)) eventually assemble in the production of proteins, assembled as body cells (M). This figure is schematic, and a universe of detail lies beyond every single thing I’ve shown. Having said that, what I depict here is enough to understand the system.


CAPTION for Figure 2-3: The night-light world of the firefly. To find a potential mate, a female has to sort through the light signals of (in this case) nine other species. Typical tracks of those other species are shown; some fly higher, some low to the ground. Some flash as the ascend (top line), some flash in repeated sequences (the eight 'blips' repeated occasionally on the fourth line down, on the left). A slight variation in the female's ability to perceive these signals, and sort through them, could prevent her from mating successfully.

(c) 2010 Cameron M. Smith

The Moment of Vocation

"The page he opened on was under the heading of Anatomy, and the first passage that drew his eyes was on the valves of the heart. He was not much acquainted with valves of any sort, but he knew that valvae were folding doors, and through this crevice came a sudden light startling him with his first vivid notion of finely adjusted mechanism in the human frame. A liberal education had of course left him free to read the indecent passages in the school classics, but beyond a general sense of secrecy and obscenity in connection with his internal structure, had left his imagination quite unbiased, so that for anything he knew his brains lay in small bags at his temples, and he had no more thought of representing to himself how his blood circulated than how paper served instead of gold. But the moment of vocation had come, and before he got down from his chair, the world was made new to him by a presentiment of endless processes filling the vast spaces planked out of his sight by that wordy ignorance which he had supposed to be knowledge. From that hour Lydgate felt the growth of an intellectual passion."

George Eliot (pen name of Mary Anne Evans), Middlemarch, 1874.

Cold-Weather People

A talk coming up in September (click above). I believe the charge is "suggested donation of $5.00 to the Oregon Archaeological Society", but I'm still waiting to hear on that.

Thirty-nine days to turn in the evolution book. Writing it is like building a bomb; touch one filament and you might blow the whole rig. It's also like flying a plane; once you're off the ground, just touch what you have to, but, basically, let the plane fly, don't try to do too much. It's also like writing a book! And that means, 'every word counts'.

Some days the stress makes me sick; some days I feel fine. I am up at 3am a lot. I've broken my rule to not print out any new research articles; I've already logged in 300 references and that's not all of them. And some illustrations to ink.

Wonders

Is it any wonder that I can't wait to get back in the water? Photo of some kind of sea life--I haven't even looked it up, yet--by my dive partner, Todd Olson.

Below, some wonder of human spirit (use linked text if the embedded video doesn't show properly);


Guillame Nery in a spectacular, single-breath Blue Hole Dive:



The late Geoff Robson flies his wingsuit in South Africa. His nervousness and elevated breathing rate before launch are very familiar to me, reminding me of launching my wing.

But it will be a while before I get back in the water...Book is due in 44 days, and my mind is spinning.

Prestin

Today, again just for sheer wonder, the base-pair sequence for the prestin gene, responsible for hearing-related structures and highly similar in echolocating life forms as diverse as bats and dolphins. Above, just for sheer wonder, original instruments used in performing Pachelbel's Canon in D.



The 2,098 Base Pairs of the prestin gene in H. sapiens sapiens:

acctggaggcagcgcgcgcgtcgaagaggcagcggctgtggagcgcggcggggcggctccgcccagggcagcccgggctgggccaaggagcgagctctcccttctcctgctctcagcctcagtgatcaaggcttcagtgaactgcactggagctcccagcgggggatcttgtcccctgtcccgacttttgtgctgcacattggatctggtgacactcaggaaatgcttgtctccggctgttaaggaataatttcagagtactatggatcatgctgaagaaaatgaaatccttgcagcaacccagaggtactatgtggaaaggcctatctttagtcatccggtcctccaggaaagactacacacaaaggacaaggttcctgattccattgcggataagctgaaacaggcattcacatgtactcctaaaaaaataagaaatatcatttatatgttcctacccataactaaatggctgccagcatacaaattcaaggaatatgtgttgggtgacttggtctcaggcataagcacaggggtgcttcagcttcctcaaggtccttttgctgttattagcctgatgattggtggtgtagctgttcgattagtaccagatgatatagtcattccaggaggagtaaatgcaaccaatggcacagaggccagagatgccttgagagtgaaagtcgccatgtctgtgaccttactttcaggaatcattcagttttgcctaggtgtctgtaggtttggatttgtggccatatatctcacagagcctctggtccgtgggtttaccaccgcagcagctgtgcatgtcttcacctccatgttaaaatatctgtttggagttaaaacaaagcggtacagtggaatcttttccgtggtgtatgcgtcgggctgatggtttttggtttgctgttgggtggcaaggagtttatgagagatttaaagagaaattgccggcgcctattcctttagagttctttgcggtcgtaatgggaactggcatttcagctgggtttaacttgaaagaatcatacaatgtggatgtcgttggaacacttcctctagggctgctacctccagccaatccggacaccagcctcttccaccttgtgtacgtagatgccattgccatagccatcgttggattttcagtgaccatctccatggccaagaccttagcaaataaacatggctaccaggttgacggcaatcaggagctcattgccctgggactgtgcaattccattggctcactcttccagaccttttcaatttcatgctccttgtctcgaagccttgttcaggagggaaccggtgggaagacacagcttgcaggttgtttggcctcattaatgattctgctggtcatattagcaactggattcctctttgaatcattgccccaggctgtgctgtcggccattgtgattgtcaacctgaagggaatgtttatgcagttctcagatctcccctttttctggagaaccagcaaaatagagctgaccatctggcttaccatttttgtgtcctccttgttcctgggattggactatggtttgatcactgctgtgatcattgctctgctgactgtgatttacagaacacagaggtgagtgcccagattggaatgggtgtgaatgtcccggcagagatgacaatgttgactttaggtgtagaccaaagtttaagttggtagaagtggagccctttgatgatttctagttagcgtgagagggagctataacactcatgtagcctgttgactagatgaacaaaatgccaatttaaaaattccatataattttgccaaatgctcttctatgtcacaatttatgctcccatcaatggttatgttaaaagagcctaatttccatcattgtttctgccattcctggtctagtgctatgctggtttatttatcctcttgtgatttgttttggcaccaagtactgacatgagcttcaatgacatgaagcaaactctgacaccaagttatcgtatgcattccttccactgtcatttcctccaccctgaaccactttcccttgttatctcttctccctagtgggaagctgagcccactagggaaagtat

*SUMMARY*

Official Full Name
solute carrier family 26, member 5 (prestin) provided by HGNC
Primary source
HGNC:9359
Ensembl:ENSG00000170615; HPRD:09224; MIM:604943
Gene type: protein coding
RefSeq status: REVIEWED
Organism: Homo sapiens
Lineage: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo
Also known as: PRES; DFNB61; MGC118886; MGC118887; MGC118888; MGC118889; SLC26A5


Summary:


This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.


Sea Garden

Above, a sketch of a colony of sea whips, filter feeders 80 feet down in Puget Sound. Todd and I found these on a steep slope that descended into pitch darkness. We've been down that slope once, to 130 feet, but this time, breathing an oxygen-rich mixture from our tanks, going below 90 feet would be flirting with oxygen toxicity dangers...so we stay shallow.

I'm kneeling to examine the many delicate filter tendrils on a sea whip. Our lamps illuminate a blizzard of specks, from krill to stray organic matter. The muddy sea floor sucks at my knees. Todd hovers above. Photons that ten minutes ago were blasted from the sun have bounced off the moon and now penetrate here, but only weakly.

Diving

The evolution book is due in 61 days..but phyletic gradualism and parapatric speciation and cytochrome B analyses are rattling around in my brain, I need some clarity, and it's time for a break. So, off to dive. In eight hours I'll be a hundred feet down, hovering just over the sea floor in Puget Sound, illuminating the moonscape with a bright light, reathing air from a cylinder. Thank you, Jacques Cousteu and the less-well-known co-inventor of the aqualung, Emile Gagnan. The two are seen above, about to test early SCUBA devices.

Random Wonders of Biology

Some assorted notes taken last night. I'm not sure which, if any, will make it into the evolution book, but that doesn't matter; knowing the material conditions how I think about everything else, including things that do make it into the material. There are typos.


The main mode of corals dispersing widely is that of planula (immature coral) larvae attaching to rafts of vegetation floating in the sea. Colonies of corals may traverse 20k-40k km in their lifetime, in the Western hemisphere making several circuits of the tropical and subtropical Pacific basin. From: Helmuth, B., R.R. Veit, R. Holberton (1994). "Long-Distance Dispersal of a Subantarctic Brooding Bivalve (Gaimardia trapesina) by Kelp-Rafting." Marine Biology 120: 421-426.

Coral reef species are amongst the widest-distributed of all organisms due to dispersal of teleplanic larvae in surfae currents and transport of adults on floating rafts. Such rafts include kelp, but also the bouyant skeletons of the reef coral Symphillia agaricia measuring around 50cmx15cmx35cm, weighing about 15kg, wet. In the Great Barrier Reef area, such rafts compose ecosystems composed of filamentous algae, goose barnacles, decapod crustaceans, pearl and reef oysters, gastropods, bryozoans, and foraminaferans. These coral skeletons wash up on beaches, dry out (becoming bouyant) and then are washed to sea again, at which time they begin to accumulate the ecosysem. From: DeVantier, L. M. (1992). "Rafting of Tropical Marine Organisms on Bouyant Coralla." Marine Ecology Progress Series 86: 301-302.

A 630bp section of coral mtDNA was found to be invariant in individuals sampled from 18 populations over 3,000km from Baja California to SE Alaska. In contrast, nuclear DNA of these populations differed as expected across such a range, particularly because these species (Balanophyllia elegans) disperse only small distances, crawling briefly on the sea floor rather than, for example, riding rafts of vegetation as in some other species. The substitution rate for this species, as in others, is calculated to be about .00055 substitutions per site per year, about the same as for plants such as rice and maize. All of this supports slow mtDNA mutation rate in anthozoans; .055% per million years, or 50-100 times slower than in an array of other animals, including sharks and shrimps. From:
Hellberg, M. E. (2006). "No Variation and Low Synonymous Substitution Rates in Coral mtDNA Despite High Nuclear Variation." BMC Evolutionary Biology 6(24).

San Juan Island hermit crabs and the snails providing their shells (*most* hermits must swich out shells they normally use for protection as they grow--some species [Pagurus] occupy shells that support colonial organisms that grow continuously from the lip of the shell) were observed from 1967 to 1970. Over 4,000 snails were tagged in the 200^m study area. About half died each year, and by May 1968 the first crab using a shell was identified. Shells were 20-40mm in length. Crabs appear to select thicker shells. Most months, .5 to 1 shell became avialable per crab (crab population varied from 100-300 in the study area). Physical processes remove available but uninhabited shells. Crabs select good shells; broken or thinner shells are more suceptibel to rpedation, produce fewer eggs, and grow more slowly (p.130). More shells wer available in spring and summer than in winter. Crab population is to a degree limited by shell availability. From: Spight, T. (1977). "Availability and Use of Shells by Intertidal Hermit Crabs." Biology Bulletin 152: 120-133.

African slendter-tailed meerkats (gregarious mongooses of the species Suricata suricatta) were observed for 26 band-years over four breeding seasons. Breeding is seasonal with most births at the rainy season and females coming into new oestrus within three weeks of giving birth. Kitten mortality was largely due to cold and predation, occurring at 3-5 weeks of age. Effective foraging independence is at 12 weeks. Some instances of infanticide were inferred; they seem more to have to do with higher-ranked females killing lower-ranked offsprings' young for ranking reasons, rather than being correlated with rainfall or other environmental variables (p.316). Offspring survival can depend on many factors, including resource (vegetation and arthropod) availability due to rainfall regime, time of female investment in young (which may vary with female health at time of birthing) and climate varaition at time of gestation, lactation and the post-weaning period (p.310). Most demanding time for females is gestation and lactation, and reproduction is scheduled for this. Breeding helpers assist in rearing offspring, and can increase survival of offspring by providing food or protecting the young. In one case, an entire litter died because a tawny eagle (Aquila rapax) prevented foraging adults--and the babysitter, who had gone without food for two days and finally left the den--from returning; the kittens froze to death in the den (p.317). other birds of prey also took young. A Cape cobra (Naja nivea) entered a den once, and was repeatedly mobbed by meerkats; one male chased the snake away after it had eaten two kittens. Overall, 35% of all kittens died at den in the first 30 days after first emergence. Cold is a major killer, and kittens huddle in the den for warmth. Over 20 spp of mammals huddle for warmth (p320). When kittens were separated from babysitters, they call until they are rescued. Flooding can kill: one babysitter single-handedly moved an entire litter from a flooding den to a dry den, over 50m, while the rest of the band were away, foraging. In the first foraging behavior, when kittens leave the den at about 4 weeks, until about 3 to 6 months, predation mortality was high, but dropped significantly after this; babysitters commonly take young into the den when predators are around. Breeding was scheduled so that birth--often simultaneous among the entire band--occurs when resources are best for the period of lactation, not the period of mating. Despite work of helpers, there was no statistical effect showing more survival with more helping (p.323). It may be that helpers actually improve fitness of reproductive-age meerkats and the young-but-not-juvenile. From: Doolan, S. P., D. W. McDonald (1997). "Breeding and Juvenile Survival Among Slender-Tailed Meerkats (Suricata suricatta) in the South-Western Kalahari: Ecological and Social Influences." Journal of Zoology 242: 309-327.

Tadpoles can respond to habitat dessication (pool drying) by accelerated metamorphosis as well as cannibalism. From: Newman, R. A. (1992). "Adaptive Plasticity in Amphibian Metamorphosis." Biosciences 42: 671-678.

Roughly 2m-diameter rafts of the kelp Macrocytis pyrifera observed in the Southern Ocean between South America and South Georgia island are small ecosystems composed of 100-200 kelp plants and, attached to them, 'colonies' of the mullosc Gaimardia trapesina; not only are adults of the mullosc found on the kelp, but young are as well, indicating that kelp rafts can serve as platforms sustaining mullosc populations on long-distance voyages. up to thousands of miles in distance.

Steller sea lions (Eumetopias jubatus) observed in Alaska's Prince William Sound feed exclusively on herring (Clupea pallasi) at night; they do not eat the much more abundant walleye pollock, which are roughly five times more abundant in these waters; in winter there is particular food source stress, but even then sea lions do not eat the pollock. However, pollock live at 100m or so depth (day and night), whereas herring schools occur closer to 15-35m deep at night. Groups of up to 50 stellers were observed swimming abreast, apparently herding the herring. Stellers can dive to 250m, but it is apparenly easier for them to herd the shallower-occurring herring than dive for the pollock. From: Thomas, G. L., and R.E. Thorne (2001). "Night-Time Predation by Steller Sea Lions." Nature 411: 1013.

Viruses are the most abundant and genetically diverse 'life forms' in the ocean; typically 10^7 viruses / ml, fewer with depth and distance from shore. They are most common where bacteria and chlorophyll are most abundant. Oceans contain perhaps 4x10^40 viruses; end-to-end they would reach 10m light years and they weigh = to 75m blue whales. These have genome sizes from 997bp to 1.1mbp (p.357) and are genetically extremely diverse. At the same time, some sequences are nearly identical at the nucleotide level in environments as distant as the Southern Ocean, Antarctica, and the Gulf of Mexico. New analysis shows that HGT has occurred between cyanobacteria and their viruses (p.358) such that "viruses capture genes of host origin and exhange them among viral progeny". On a daily basis, oceanic viruses kill 20-40% of all marine bacteria, and contribute to microbial mortality at a level similar to that of grazing by zooplankton. From Suttle, C. A. (2005). "Viruses in the Sea." Nature 437: 356-361.

Romanian tadpoles were observed to cannibalize conspecifics during a period when their pond was drying and crowded with tadpoles. This is an instance verifying other such instances of adaptive behavioral placticity as noted in Newman (1992). Kovacs, E. H. a. I. S. (2009). From: "Cannibalistic Behaviour of Epidalea (Bufo) viridis Tadpoles in and Urban Breeding Habitat." North-Western Journal of Zoology 5(1): 206-208.