Friday, August 6, 2010

Prestin



Today, again just for sheer wonder, the base-pair sequence for the prestin gene, responsible for hearing-related structures and highly similar in echolocating life forms as diverse as bats and dolphins. Above, just for sheer wonder, original instruments used in performing Pachelbel's Canon in D.



The 2,098 Base Pairs of the prestin gene in H. sapiens sapiens:

acctggaggcagcgcgcgcgtcgaagaggcagcggctgtggagcgcggcggggcggctccgcccagggcagcccgggctgggccaaggagcgagctctcccttctcctgctctcagcctcagtgatcaaggcttcagtgaactgcactggagctcccagcgggggatcttgtcccctgtcccgacttttgtgctgcacattggatctggtgacactcaggaaatgcttgtctccggctgttaaggaataatttcagagtactatggatcatgctgaagaaaatgaaatccttgcagcaacccagaggtactatgtggaaaggcctatctttagtcatccggtcctccaggaaagactacacacaaaggacaaggttcctgattccattgcggataagctgaaacaggcattcacatgtactcctaaaaaaataagaaatatcatttatatgttcctacccataactaaatggctgccagcatacaaattcaaggaatatgtgttgggtgacttggtctcaggcataagcacaggggtgcttcagcttcctcaaggtccttttgctgttattagcctgatgattggtggtgtagctgttcgattagtaccagatgatatagtcattccaggaggagtaaatgcaaccaatggcacagaggccagagatgccttgagagtgaaagtcgccatgtctgtgaccttactttcaggaatcattcagttttgcctaggtgtctgtaggtttggatttgtggccatatatctcacagagcctctggtccgtgggtttaccaccgcagcagctgtgcatgtcttcacctccatgttaaaatatctgtttggagttaaaacaaagcggtacagtggaatcttttccgtggtgtatgcgtcgggctgatggtttttggtttgctgttgggtggcaaggagtttatgagagatttaaagagaaattgccggcgcctattcctttagagttctttgcggtcgtaatgggaactggcatttcagctgggtttaacttgaaagaatcatacaatgtggatgtcgttggaacacttcctctagggctgctacctccagccaatccggacaccagcctcttccaccttgtgtacgtagatgccattgccatagccatcgttggattttcagtgaccatctccatggccaagaccttagcaaataaacatggctaccaggttgacggcaatcaggagctcattgccctgggactgtgcaattccattggctcactcttccagaccttttcaatttcatgctccttgtctcgaagccttgttcaggagggaaccggtgggaagacacagcttgcaggttgtttggcctcattaatgattctgctggtcatattagcaactggattcctctttgaatcattgccccaggctgtgctgtcggccattgtgattgtcaacctgaagggaatgtttatgcagttctcagatctcccctttttctggagaaccagcaaaatagagctgaccatctggcttaccatttttgtgtcctccttgttcctgggattggactatggtttgatcactgctgtgatcattgctctgctgactgtgatttacagaacacagaggtgagtgcccagattggaatgggtgtgaatgtcccggcagagatgacaatgttgactttaggtgtagaccaaagtttaagttggtagaagtggagccctttgatgatttctagttagcgtgagagggagctataacactcatgtagcctgttgactagatgaacaaaatgccaatttaaaaattccatataattttgccaaatgctcttctatgtcacaatttatgctcccatcaatggttatgttaaaagagcctaatttccatcattgtttctgccattcctggtctagtgctatgctggtttatttatcctcttgtgatttgttttggcaccaagtactgacatgagcttcaatgacatgaagcaaactctgacaccaagttatcgtatgcattccttccactgtcatttcctccaccctgaaccactttcccttgttatctcttctccctagtgggaagctgagcccactagggaaagtat

*SUMMARY*

Official Full Name
solute carrier family 26, member 5 (prestin) provided by HGNC
Primary source
HGNC:9359
Ensembl:ENSG00000170615; HPRD:09224; MIM:604943
Gene type: protein coding
RefSeq status: REVIEWED
Organism: Homo sapiens
Lineage: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo
Also known as: PRES; DFNB61; MGC118886; MGC118887; MGC118888; MGC118889; SLC26A5


Summary:


This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.

No comments:

Post a Comment